Скачать или смотреть The human telomeric parallel G-quadruplex X-ray structure

This structure has received a lot of publicity recently, thanks to the recent demonstration that the parallel G-quadruplex is indeed present in living human cells. This set of X-ray coordinates was obtained in 2002, and published in Nature, by Parkinson, Lee and Neidle. The reference is Nature 417: 876-880
The coordinates can be downloaded as pdb entry 1KF1 or ndb entry ud0017.
The structure is formed from a single strand of DNA, of sequence
AGGGTTAGGGTTAGGGTTAGGG, with three potassium ions in the central channel, and in between the layers.
The structure is held together by the hydrogen bonds within the layers, the stacking forces between the layers, and the 8-coordination of the potassium ions to the guanine oxygen atoms. It has proved difficult to target because the quadruplex unit is rather stable (drugs do not intercalate into it), but also because the loop structures round the edge are variable and not always parallel. So there are nmr coordinates for other structures.